Презентация к уроку английского языка "Forensic DNA Analysis" - скачать бесплатно

Сентябрь 1, 2022

Главная
Английский язык
Презентация к уроку английского языка "Forensic DNA Analysis" - скачать бесплатно

Содержание

2. Forensics, pertaining to the courts either criminal or civil Forensics DNA analysis is the use of
3. Originally identification was limited to: Physical attributes such as; ethnicity, gender, height, weight, hair color, etc.
4. Even though two unrelated humans differ in their DNA only by 0.1 to 0.2% there are
5. Restriction Fragment Length Polymorphism (RFLP) Detects a single basepair change in DNA Must occur within a
6. http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htm RFLP
8. DNA Fingerprinting First described in 1985 by Alec Jeffreys as a method for identifying individuals by
9. During the late 80s/early 90s US courts questioned the validity of DNA profiling The debates centered
10. What creates this unique pattern? Satellite DNA: repetitive DNA sequence. Macrosatellite: core sequence 100 to 6500bp
11. Repeats of Satellite DNA Repeat units vary in length from 2bp to long stretches of 6000bp
12. http://www.usask.ca/biology/rank/316/genomics/genomics.htm One Mechanism of VNTR Creation
13. Southern blotting can be used to visualize the variation Probes specific to the repeat unit are
14. http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htm
15. http://www.mun.ca/biology/scarr/DNA_fingerprinting.htm Multi-loci DNA Fingerprint
16. Multi-locus analysis of Dolly used to prove she was a clone 1 –12 are control sheep
17. http://www.genelex.com/paternitytesting/paternityslide2.html Single-Locus VNTR Single-locus mini/microsatellite VNTRs generates at most two bands Though not as unique as
18. Skeletal remains exhumed from a site in Brazil in 1985 that were thought to be those
19. PCR amplification of VNTR PCR is particularly useful in forensic analysis as it allows minute amounts
22. Short Tandem Repeats (STR) Are a variation on VNTRs, but use the smallest repeats units often
23. STRs are isolated using PCR Primers have been developed to allow amplification of multiple STR loci
24. Following the PCR reaction, internal DNA length standards are added to the reaction mixture The DNAs
25. http://www.biology.arizona.edu/human_bio/activities/blackett2/str_analysis.html Analysis of 3 STRs, D3S1358, vWA, & FGA Reference standards with the known alleles for
26. Example of a DNA profile using the 13 CODIS STR The odds of another person having
27. CODIS (Combined DNA Index System) In 1997, the FBI announced the selection of 13 STR loci
28. http://www.cstl.nist.gov/div831/strbase/images/codis.jpg
30. Скачать презентацию

Слайд 2

Forensics, pertaining to the courts either criminal or civil
Forensics DNA analysis

is the use of DNA evidence
Used in:
paternity suites
victim identification
identifying suspects

Слайд 3

Originally identification was limited to:
Physical attributes such as; ethnicity, gender, height,

weight, hair color, etc.
Friction-ridge identification or fingerprinting
Blood-antigen & serum proteins, ABO blood groups

Слайд 4

Even though two unrelated humans differ in their DNA only by

0.1 to 0.2% there are still up to 6 million basepair differences
It is these differences that are used to create a unique DNA “fingerprint” also known as DNA profile

Слайд 5

Restriction Fragment Length Polymorphism (RFLP)
Detects a single basepair change in DNA
Must

occur within a restriction enzyme cleavage sequence to be visible
Often used in disease screening such as in the detection of sickle cell anemia
DNA fragments are often visualized by Southern Blot

Слайд 6

http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htm
RFLP

Слайд 7

Слайд 8

DNA Fingerprinting
First described in 1985 by Alec Jeffreys as a method

for identifying individuals by their unique pattern of DNA banding
First use of DNA fingerprinting was in a 1985 immigration case in the UK. It identified a child as being the offspring of a British citizen
It was then used to rule out a suspect in a rape/murder case in England in 1986

Слайд 9

During the late 80s/early 90s US courts questioned the validity of

DNA profiling
The debates centered on evidence collection procedures, training of technicians, & the statistics used to establish a match
By the mid 1990s DNA profiling was shown to be scientifically valid and DNA evidence became admissible

Слайд 10

What creates this unique pattern?
Satellite DNA: repetitive DNA sequence.
Macrosatellite: core sequence

100 to 6500bp
Minisatellite: core sequence of 10-20bp repeated multiple times
Microsatellite: small arrays of tandem repeats of 2 to 4bp in length
(AT)n account for 0.3% of the human genome
(CATG)n accounts for 0.5% of the human genome

Слайд 11

Repeats of Satellite DNA
Repeat units vary in length from 2bp to

long stretches of 6000bp or more
These repeat units are lined up head to tail and compose satellite DNA and are interspersed throughout the genome
The number of units varies person to person
Thus these sequences are called VNTRs (variable number of tandem repeats)
A VNTR is a locus that is hypervariable due to a large number of alleles each characterized by a different number of repeat units

Слайд 12

http://www.usask.ca/biology/rank/316/genomics/genomics.htm
One Mechanism of VNTR Creation

Слайд 13

Southern blotting can be used to visualize the variation
Probes specific to

the repeat unit are hybridized to DNA cut with a restriction enzyme that cuts just outside the VNTR
This allows for the difference in VNTR length to be detected
Two common probes are known are:
33.6 (AGGGCTGGAGG)18
31.5 (AGAGGTGGGCAGGTGG)29
These are multi-locus minisatellite probes and show about 17 different DNA bands for each individual

Слайд 14

http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htm

Слайд 15

http://www.mun.ca/biology/scarr/DNA_fingerprinting.htm
Multi-loci DNA Fingerprint

Слайд 16

Multi-locus analysis of Dolly used to prove she was a clone
1

–12 are control sheep
U is original udder cells
C is cells from culture
D is Dolly blood cells

Слайд 17

http://www.genelex.com/paternitytesting/paternityslide2.html
Single-Locus VNTR
Single-locus mini/microsatellite VNTRs generates at most two bands
Though not as

unique as multi-locus VNTRs they are simple to use
Multiple single-locus VNTRs are used to give a DNA fingerprint

Слайд 18

Skeletal remains exhumed from a site in Brazil in 1985 that

were thought to be those of the Nazi, Josef Mengele
The profile of DNA extracted from a femur (F) was compared with those of his son (R) and wife (I) at 10 different loci, & found to be fully compatible with paternity of Mengele’s son

Actin Mfd49

Слайд 19

PCR amplification of VNTR
PCR is particularly useful in forensic analysis as

it allows minute amounts of DNA to be analyzed
DNA can be obtained from blood stains, semen, saliva, or hair roots
Instead of digesting the DNA PCR is used to amplify the VNTRs and the products are run on a gel and visualized by staining
This process requires primers that anneal just outside the VNTR

Слайд 20

Слайд 21

Слайд 22

Short Tandem Repeats (STR)
Are a variation on VNTRs, but use the

smallest repeats units often only 2 to 4 bp in length
aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatggagt
tattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacgaa
ctaacgatagatagatagatagatagatagatagatagatagatagatagatagacagat
tgatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatttg
13 core loci of tetrameric repeats are tested together to make a DNA profile
The sequence above is locus D7S280 which is located on chromosome 7

Слайд 23

STRs are isolated using PCR
Primers have been developed to allow amplification

of multiple STR loci in a single reaction mixture
Each primer set has been optimized such that its product, no matter the number of STRs, is not the same size as any of the other products
Each primer set has unique fluorescent molecules covalently linked to them so that they may be visualized immediately by a computer

Слайд 24

Following the PCR reaction, internal DNA length standards are added to

the reaction mixture
The DNAs are separated by length in a capillary gel electrophoresis machine
As DNA peaks elute from the gel they are detected with laser activation
The results are then graphed by a computer which compares them to a standard

Слайд 25

http://www.biology.arizona.edu/human_bio/activities/blackett2/str_analysis.html
Analysis of 3 STRs, D3S1358, vWA, & FGA
Reference standards with the

known alleles for each STR locus
Profile of test subject

Genotype is 15, 15 @ D3S1358, 14, 16 @ vWA, & 24, 25 @ FGA

Слайд 26

Example of a DNA profile using the 13 CODIS STR
The odds

of another person having this profile 1 in 7.7 x 1015

Слайд 27

CODIS (Combined DNA Index System)
In 1997, the FBI announced the selection

of 13 STR loci to constitute the core of the United States national database, CODIS
All forensic laboratories that use the CODIS system can contribute to the national database
The STRs alleles are easily genotyped using commercial kits
All data from these analyses are digital thus easily placed in the database

Слайд 28

Презентация к уроку английского языка "Forensic DNA Analysis" - скачать бесплатно

Содержание

Forensics, pertaining to the courts either criminal or civilForensics DNA analysis

Originally identification was limited to:Physical attributes such as; ethnicity, gender, height,

Even though two unrelated humans differ in their DNA only by

Restriction Fragment Length Polymorphism (RFLP)Detects a single basepair change in DNAMust

http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htmRFLP

DNA FingerprintingFirst described in 1985 by Alec Jeffreys as a method

During the late 80s/early 90s US courts questioned the validity of

What creates this unique pattern?Satellite DNA: repetitive DNA sequence. Macrosatellite: core sequence

Repeats of Satellite DNARepeat units vary in length from 2bp to

http://www.usask.ca/biology/rank/316/genomics/genomics.htmOne Mechanism of VNTR Creation

Southern blotting can be used to visualize the variationProbes specific to

http://bioweb.uwlax.edu/GenWeb/Molecular/Bioinformatics/Unit_3/Lec_3-1/figs3-1/figs3-1.htm

http://www.mun.ca/biology/scarr/DNA_fingerprinting.htmMulti-loci DNA Fingerprint

Multi-locus analysis of Dolly used to prove she was a clone1

http://www.genelex.com/paternitytesting/paternityslide2.htmlSingle-Locus VNTRSingle-locus mini/microsatellite VNTRs generates at most two bandsThough not as